This reverse complement calculator transforms a DNA sequence three ways — reverse, complement, and the all-important reverse complement (the sequence of the opposite strand, written 5′→3′) — with IUPAC ambiguity codes handled correctly.
Why the Reverse Complement Is the Operation
DNA strands run antiparallel: one strand’s 5′→3′ sequence pairs with a partner read the opposite way. Every tool in molecular biology — primer design, probe matching, BLAST alignments, CRISPR guide checks — constantly asks “what does the other strand say, written 5′→3′?” and the answer is always: complement each base (A↔T, G↔C), then reverse the order. This calculator does all three transformations and honors the full IUPAC ambiguity alphabet (R pairs with Y, K with M, B with V, and so on) — the details string utilities get wrong. Analyze composition with our GC Content Calculator. Part of our Biology Calculators collection.
Worked Example (Verified)
- Input: ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG
- Reverse complement: CTATCGGGCACCCTTTCAGCGGCCCATTACAATGGCCAT — check the ends: the input starts ATG (the start codon), so the RC correctly ends in CAT, the reverse complement of ATG
- Round-trip test you can trust: feeding the RC back through this tool returns the original sequence exactly — reverse complement is its own inverse
Where Each Transform Belongs
- Reverse complement: primers for the opposite strand, reverse-strand gene sequences, probe and guide-RNA counterpart checks.
- Complement alone: visualizing the paired strand in place (as in textbook duplex diagrams, 5′→3′ over 3′→5′).
- Reverse alone: rarely biological — its honest uses are string exercises and checking palindromic restriction sites (a true palindrome in DNA means the sequence equals its own reverse complement — EcoRI’s GAATTC is the famous case, and you can verify it above).
- RNA input (with U) is accepted; U complements to A.
Related Tools
- GC Content Calculator — composition and Tm
- Biology Calculators — the full collection
Frequently Asked Questions
How do you find the reverse complement of a DNA sequence?
Replace each base with its complement (A↔T, G↔C), then reverse the whole string. ATGGC becomes GCCAT. This page does it for sequences of any practical length, ambiguity codes included.
Why not just the complement?
Because strands are antiparallel. The complement in the same order reads 3′→5′ — backwards for every tool that expects 5′→3′ input (primers, database sequences, synthesis orders). The reverse step is what makes it the true partner strand written conventionally.
What are IUPAC ambiguity codes?
Letters for uncertain bases: R = A/G, Y = C/T, S = G/C, W = A/T, K = G/T, M = A/C, B = not-A, D = not-C, H = not-G, V = not-T, N = any. Complements pair them consistently (R↔Y, K↔M, B↔V, D↔H), which this calculator implements.
What is a reverse-complement palindrome?
A sequence identical to its own reverse complement — the pattern restriction enzymes recognize (GAATTC for EcoRI; verify by pasting it above: output equals input). CRISPR and cloning workflows check for these constantly.
Does it work for RNA sequences?
Yes — U is accepted and complements to A (the DNA counterpart base). For RNA-to-RNA complement work the same letter logic applies with U in place of T in outputs where relevant; the tool’s mapping is documented in the results it returns.
Is this reverse complement calculator free?
Yes — free, instant, and sequences never leave your browser.