This GC content calculator analyzes a DNA sequence: GC percentage, the count of every base, and a basic melting-temperature estimate for primers — paste a sequence, get the breakdown.
The Wallace rule (2°C per A/T pair + 4°C per G/C pair) is a first estimate for short oligos; primers over ~20 bases deserve a nearest-neighbor Tm calculation with salt and primer concentrations.
Why GC Content Runs Molecular Biology
G–C pairs bind with three hydrogen bonds against A–T's two, so GC-rich DNA is physically tougher: it melts at higher temperatures, amplifies differently in PCR, and sequences differently on every platform. Genomes carry signatures — most bacteria sit between 25% and 75% GC, humans near 41%, and the GC of a mystery fragment can identify its origin kingdom before a single gene is named. Primer designers live at 40–60% GC with a G or C at the 3′ end (the "GC clamp"). Part of our Biology Calculators collection, alongside the Reverse Complement Calculator.
Worked Example (Verified)
- Sequence: ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG (39 bases)
- Counts: A 9, T 8, G 14, C 8 → GC = 22 ÷ 39 = 56.4%
- A 20-base oligo from its start (ATGGCCATTGTAATGGGCCG): A+T = 9, G+C = 11 → Wallace Tm = 2×9 + 4×11 = 62 °C, GC 55.0% — a well-behaved primer sketch
Practical Reading of the Number
- Primers: 40–60% GC, Tm 55–65 °C, matched within ~2 °C between the pair — the constraints every PCR troubleshooting guide re-derives.
- Amplicons: high-GC targets (>65%) amplify reluctantly (additives like DMSO or betaine exist for them); very low-GC targets misprime.
- Genome skims: a "contaminant" contig often betrays itself by GC alone — a 35% fragment in a 65% genome is a stranger.
- N bases (ambiguous calls) count toward length here but neither GC nor AT — the honest handling.
Related Tools
- Reverse Complement Calculator — the strand partner
- Biology Calculators — the full collection
Frequently Asked Questions
How is GC content calculated?
(G + C bases) ÷ total bases × 100. The example sequence has 22 G/C out of 39 bases: 56.4% GC. Ambiguous N bases count in the total but in neither GC nor AT.
What is a good GC content for PCR primers?
40–60%, with a G/C at or near the 3′ end (GC clamp) for stable priming, and melting temperatures of 55–65 °C matched between the forward and reverse primers.
Why does GC content affect melting temperature?
G≡C pairs share three hydrogen bonds versus A=T's two, and GC stacking interactions are stronger still — so GC-rich duplexes need more thermal energy to separate. The Wallace rule (2°/AT + 4°/GC) prices that difference for short sequences.
What GC content is the human genome?
About 41% on average — but it varies by region: gene-rich, early-replicating regions run GC-richer (isochores), and CpG islands near promoters spike locally. Averages hide structure, as always.
Does this calculator accept FASTA format?
Yes — lines starting with ">" are skipped as headers, and whitespace/line breaks are ignored, so a pasted FASTA record analyzes cleanly.
Is this GC content calculator free?
Yes — free, instant, and your sequence never leaves your browser.