This melting temperature calculator reads a DNA primer sequence and returns its length, GC content, melting temperature (Tm) by the method appropriate to its length, and a suggested annealing temperature (Ta) for PCR. Paste the primer 5’→3′ exactly as you ordered it.

–

Two Formulas, Honest About Their Weight Class

Tm is the temperature at which half the primer–template duplexes have melted apart — a property of sequence, salt and concentration, not of sequence alone. The calculator’s default 20-mer (ATGCGTACGTTAGCCGGATC, 11 G/C of 20, GC 55%) returns Tm = 64.9 + 41 × (11 − 16.4)/20 = 53.8 °C by the basic formula and a suggested annealing start of ≈ 48.8 °C. Short primers get the Wallace 2/4 rule (the 12-mer ATCGATCGATCG: 2×6 + 4×6 = 36 °C), a beloved back-of-envelope that degrades gracefully until it doesn’t — beyond ~14 nt it overshoots, which is why the switch is automatic here and why both numbers print in the note. Professional design adds the nearest-neighbor (NN) model: stacking energies between adjacent base pairs, terminal corrections, and explicit salt/primer-concentration terms, typically landing within a degree or two of the basic formula for ordinary primers at standard conditions — the basic figure is the right planning number, the NN figure is the ordering-site confirmation, and a gradient cycler run is the empirical verdict that outranks both.

Design rules the number serves: aim primers at Tm 55–65 °C (polymerase extension at 72 °C needs a duplex that survives long enough at annealing), keep pair Tm within ~2 °C (the cycler offers only one Ta per run), hold GC at 40–60% with a G/C “clamp” at the 3′ end where affordable, and distrust any single formula when the sequence is extreme (very GC-rich templates melt late and amplify stubbornly — additives, not arguments, fix those). Annealing temperature is a STARTING BID: Ta = Tm − 5 °C, then gradient ±5 °C around it.

Worked Examples (Verified)

  • Default 20-mer: GC 11/20 = 55.0% → Tm 53.8 °C (basic), Ta ≈ 48.8 °C.
  • Wallace 12-mer: ATCGATCGATCG → 2(6) + 4(6) = 36 °C.
  • GC-poor 20-mer (GC = 6, 30%): Tm = 64.9 + 41 × (6 − 16.4)/20 = 43.6 °C — lengthen the primer rather than lowering standards: two more G/C-bearing bases buy ~4 °C.

Tm Discipline

  • Enter the primer ONLY (5’→3′), not the template or the amplicon — tails added for cloning (restriction sites, overhangs) don’t anneal in early cycles and must be excluded from the Tm of the first rounds (count them for later cycles/protocols separately).
  • Salt and primer concentration move real Tm by degrees: high Mg²⁺ stabilizes duplexes (raises effective Tm); the formulas here assume standard conditions (~50 mM monovalent, ~0.2 µM primer).
  • Pair matching beats absolute accuracy: a pair both at “wrong-but-equal” Tm outperforms a mismatched pair of individually perfect values on the shared cycler program.
  • Degenerate primers (mixed bases) have a Tm RANGE, not a point — judge by the lowest-Tm variant when setting Ta.
  • For qPCR probe design (TaqMan), probe Tm targets run ~8–10 °C ABOVE primer Tm by design convention — different target, same physics.

Related Tools

Frequently Asked Questions

How do you calculate primer melting temperature?

For short primers (<14 nt), the Wallace rule: Tm = 2 °C × (A+T) + 4 °C × (G+C). For longer primers, the basic formula Tm = 64.9 + 41 × (#GC − 16.4) / length. Default 20-mer (11 GC): 53.8 °C. This calculator picks the method by length, counts GC%, and suggests an annealing temperature 5 °C below Tm.

What is annealing temperature and how is it chosen?

Annealing temperature (Ta) is the cycler step where primers bind the template. Start at Ta ≈ Tm − 3 to 5 °C (the lower-Tm primer of the pair governs), then optimize with a gradient run: too low → nonspecific bands and primer-dimers; too high → weak or no product. The Biology hub’s annealing-temperature question and this page’s Tm answer are one workflow — Ta is derived from Tm, which is why both hub items resolve here.

Why do different calculators give different Tm values?

Because Tm depends on the model AND the conditions: Wallace and basic formulas are sequence-only approximations; nearest-neighbor calculators add stacking thermodynamics plus YOUR salt, Mg²⁺ and primer concentrations. Spreads of 2–5 °C between methods are normal. Use one method consistently within a project, match pairs by the same method, and let gradient PCR arbitrate the final degree.

What GC content should a primer have?

40–60% is the design sweet spot: below ~35% the primer binds weakly and specifically suffers (extend its length to recover Tm); above ~65% the duplex — and the template region itself — resists melting and invites secondary structure. A G or C at the 3′ terminal position or two (the “GC clamp”) stabilizes the end the polymerase extends from; three or more G/C in the last five bases overshoots into mispriming risk.

How close must the two primers’ Tm be?

Within about 2 °C by the same calculation method. The thermal cycler runs ONE annealing temperature; a mismatched pair forces a compromise where the low-Tm primer misprimes or the high-Tm primer underbinds. Adjust by lengthening/shortening the offending primer a few bases at its 5′ end — Tm tuning is length tuning, mostly.

Does primer concentration change Tm?

Yes — Tm rises with primer concentration (more primer drives duplex formation), typically a few degrees across the 0.05–1 µM working range, and salt/Mg²⁺ shifts are of similar size. Sequence-only formulas bake in standard assumptions; NN tools that ask for your concentrations are refining exactly these terms. For routine PCR the effect is inside the gradient’s search range; for diagnostic-grade assays it is modeled explicitly.

What Tm do I need for PCR at 72 °C extension?

Primers anneal at Ta (50–65 °C in most protocols) and the polymerase extends as the cycler ramps — the duplex needs to survive the ramp into the low 70s, which primers with Tm 55–65 °C do comfortably for the short time involved (two-step PCR even merges annealing/extension at ~60–68 °C for high-Tm primers). Very low-Tm primers (<50 °C) fail two-step protocols and struggle generally — redesign longer.

Is this melting temperature calculator free?

Yes — free, instant, no sign-up. Paste a primer sequence for its Tm by the length-appropriate formula, GC content, length and a starting annealing temperature.